Subscribe to the BioNews newsletter for free

Login
Advanced Search

Search for
BioNews

Like the Progress Educational Trust on Facebook


 


 

'Father of genomics' Fred Sanger dies aged 95

25 November 2013

By Dr James Heather

Appeared in BioNews 732

Fred Sanger, renowned biochemist, has died aged 95. Having pioneered seminal techniques for the understanding of both proteins and DNA, Dr Sanger is widely hailed as one of the most influential scientists of recent years.

He is one of only four people to receive two Nobel Prizes, and the only person among those to receive both in Chemistry.

Dr Sanger began his career at the University of Cambridge, UK, where he undertook his undergraduate and postgraduate studies, after which he began the work that would earn him his first Nobel Prize. Dr Sanger had developed a method to determine the order of amino acids in a protein, which he used to 'sequence' insulin.

Sanger's method involved using a chemical reagent – DNFB – that only reacts with amino acids at one end of a protein chain – the 'amino' end. He used this chemical to label insulin, before breaking it up into the individual amino acids, selecting out the labelled ones and seeing which amino acid they were.

Inspection of the DNFB-labelled components revealed there were two different amino acids present, and hence two polypeptide chains in the insulin protein. By fragmenting these chains into different length stretches of amino acids, and then using DNFB again, he was able to deduce the exact order of all of the amino acids in both chains, as well as how the chains were joined together.

This was the first time such a feat had been accomplished, providing a protocol and rationale which could be applied to all proteins. Moreover, it helped reveal the relationship between the structure and function of proteins, hugely increasing our understanding of these important molecules.

In 1962 he moved to the Laboratory of Molecular Biology (LMB), an institution with a long history of Nobel laureates. Here, he began to apply himself to solving a comparable problem with a completely different type of molecule; how to sequence the nucleic acids, RNA and DNA, which encode our genetic information.

The technique he developed was known as the chain-termination, or 'dideoxy' method. In this method, DNA to be sequenced is copied using the enzyme DNA polymerase, which incorporates the DNA nucleotide – or bases – into the growing chain. The trick of Sanger's method was to also include modified versions of each of the bases – so called dideoxy nucleotides – at very low concentrations. Dideoxy bases lack a certain chemical group required for addition of subsequent bases; thus addition of a dideoxy base stops that chain of DNA from growing.

Sanger labelled each different dideoxy base with radioactivity, and then performed four different DNA polymerase reactions, each with a different labelled chain-terminator present (A, C, T or G), before using a technique to separate the produced DNA molecules based on their lengths. By 'reading' from the shortest chain to the longest, he was able to see the order of the DNA bases in the original chain, by seeing in which reaction the radioactivity was present for a given nucleotide.

It is from this technique that Sanger became known as the 'father of genomics', having used it to sequence an entire viral genome, followed by the genome of human mitochondria, the component of our cells responsible for producing energy. Not only did this represent the first genome sequenced and the first instalment of the human genome respectively, his technology was later automated, and went on to be used to produce the first draft of the Human Genome Project.

'It is simply impossible to overestimate the impact he has had on modern genetics and molecular biology', said Dr Venki Ramakrishnan, current Deputy Director of the LMB. 'Moreover, by his modest manner and his quiet and determined way of carrying out experiments himself right to the end of his career, he was a superb role model and inspiration for young scientists everywhere'.

Few biologists in the last century can claim to have had such far reaching impact as Fred Sanger. The DFNB reagent he used to label amino groups for protein sequencing, the dideoxy method of DNA sequencing, and the Wellcome Trust funded centre of British genomics have all adopted his name, a telling marker of how indelibly he has contributed to science.

Perhaps the most fitting tribute came on Twitter, from science writer Ed Yong, who posted:

'CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC'.

This message was written in the language of DNA, which encode the amino acids that form protein chains. Combining the two biological languages that Sanger taught us how to read, this simply translates to:

'R I P F R E D S A N G E R'.

SOURCES & REFERENCES
The Guardian | 20 November 2013
 
Science Media Centre | 20 November 2013
 
The Independent | 20 November 2013
 
BBC News | 20 November 2013
 

RELATED ARTICLES FROM THE BIONEWS ARCHIVE

23 March 2015 - by Hannah Somers 
Professor Sir Venkatraman Ramakrishnan has been confirmed to succeed Sir Paul Nurse as the President Elect of the Royal Society as of December this year...

15 April 2013 - by Professor Martin H Johnson 
Robert Geoffrey Edwards, or 'Bob' as his colleagues and friends knew him, is one of the true giants of the 20th century...
03 October 2011 - by Julianna Photopoulos 
The Australian gynaecologist and pioneer of IVF, Professor Carl Wood, has died at the age of 82 after his long battle with Alzheimer's disease...
10 January 2010 - by Heidi Colleran 
Distinguished embryologist Denis New, who developed seminal techniques for embryo culture, has died at the age of 80, reports The Guardian newspaper....
07 October 2004 - by BioNews 
Maurice Wilkins, the scientist who shared a Nobel Prize with Francis Crick and James Watson for working out the structure of DNA, has died. Wilkins was awarded the prize in 1962, following his work at King's College London, in which he used X-ray techniques to show that the DNA molecule...

HAVE YOUR SAY
Be the first to have your say.

You need to or  to add comments.

By posting a comment you agree to abide by the BioNews terms and conditions


- click here to enquire about using this story.

Published by the Progress Educational Trust

CROSSING FRONTIERS

Public Conference
London
8 December 2017

Speakers include

Professor Azim Surani

Professor Magdalena Zernicka-Goetz

Professor Robin Lovell-Badge

Sally Cheshire

Professor Guido Pennings

Katherine Littler

Professor Allan Pacey

Dr Sue Avery

Professor Richard Anderson

Dr Elizabeth Garner

Dr Andy Greenfield

Dr Anna Smajdor

Dr Henry Malter

Vivienne Parry

Dr Helen O'Neill

Dr César Palacios-González

Philippa Taylor

Fiona Fox

Sarah Norcross

Sandy Starr


BOOK HERE

Good Fundraising Code

Become a Friend of PET HERE and give the Progress Educational Trust a regular donation